AT, dihydroxyacetone phosphate acyltransferase; AT, acyltransferase; G3P, glycerol-3-phosphate; GPAT, glycerol-3-phosphate acyltransferase; LPA, lysophosphatidic acid; 16:0-OH, 16:0 primary fatty alcohol; 18:0-OH, 18:0 key fatty alcohol.21984 JOURNAL OF BIOLOGICAL CHEMISTRYVOLUME 289 ?Quantity 32 ?AUGUST 8,Reconstitution of Ether Lipid Synthesis in Yeastto accumulate significant amounts of wax esters, like the skin as well as the eyelid, or ether lipids, like the brain, have been identified (12). They both possess a C-terminal extension of 66 amino acids potentially representing a transmembrane domain which is accountable for their targeting to peroxisomes (13). Plant and insect FARs are devoid of such a hydrophobic domain and may be soluble or related with the endoplasmic reticulum (three, 11). Following their synthesis, principal fatty alcohols are utilized as acyl acceptors by wax synthases to produce wax esters within the endoplasmic reticulum or to replace the acyl-chain of sn-1acyl-dihydroxyacetone phosphate by alkyl-dihydroxyacetone phosphate synthase (ADPS) to generate an ether bond linkage within the peroxisomes (five, 8). Inside the latter case, acylation of DHAP with an acyl-CoA by the peroxisomal DHAP acyltransferase (DHAPAT) is viewed as the initial step of ether lipid biosynthesis (8). Because wax synthase enzymes also belong towards the acyltransferase (AT) superfamily, both wax ester and ether lipid biosynthesis depend on FAR and AT activities. Tetrahymena species are unicellular ciliate protozoa that have been utilised as models for molecular and cellular biology for decades, in particular for studying lipid composition changes in response to modification on the environmental temperature (14). Tetrahymena pyriformis is characterized by the presence of higher amounts of ether glycerolipids which are especially enriched in phosphatidylcholine and 2-aminoethyl-phosphonolipid (15). The presence of smaller amounts of wax esters in T.BuyN-Methylhex-5-en-1-amine pyriformis enriched in branched fatty acids and alcohols has also been reported (16).1196155-05-1 manufacturer Employing the genomic resource generated from the sequencing with the macronucleus from Tetrahymena thermophila (17), we report right here the functional characterization on the distinctive ORF coding for any FAR present within the genome of this organism.PMID:24059181 The corresponding protein consists of apparently not just a putative FAR domain but also an acyltransferase-like domain at its C terminus, whereas, in most organisms, FARs are monofunctional proteins. Employing heterologous expression in plant and yeast with each other with in vitro assays, we show that this protein localizes in the peroxisomes and is bifunctional with its N-terminal finish carrying FAR activity, whereas its C-terminal end displays DHAPAT activity. Its coexpression with T. thermophila ADPS resulted in implementing ether lipid biosynthesis in yeast, suggesting that this FAR-like protein provides each substrates essential by ADPS to initiate ether lipid biosynthesis in the peroxisomes. pVT-LEU by ligation utilizing BamHI and XhoI restriction web-sites, yielding pVTLEU-TtFARAT. TtFAR and TtAT were amplified by PCR employing pUC57-TtFARAT as a template and pairs of primers containing the attB1 and attB2 flanking sequences for Gateway recombinational cloning technologies (18) as follows: far-f (GGGGACAAGTTTGTACAAAAAAGCA GGCTGGATCCACATAATGGGAAAGGTTTTCCAATTCTACGAAGGAAAGACTGTTTTGTTGACTGG) with far-r (GGGACCACTTTGTACAAG AAAGCTGGGTACTCGAGTTACTTGAATGGCTTTCCAGAAGACAAAGCCCAGTTGATATCAGAGAAGTATGGG) and at-f (GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATCCACATAATGCCA.